Global Journal of Science Frontier Research, G: Bio-Tech & Genetics, Volume 22 Issue 2

b) Yeast Synthetic Genome, the case of the longer chromosome XII Since 2012 the Synthetic Yeast Genome Project (Sc2.0 http://syntheticyeast.org/sc2-0/) results from a worlwide partnership, « Sc2.0 International Consortium team », members spanning 4 continents to provide remote mentorship and solve challenges associated with synthetic individual chromosomes design features and assembly (Jee Loon Foo, 2018). Sources synthetic yeast project http://syntheticyeast.org/ 7 chromosomes now synthetised http://syntheticyeast.org/sc2-0-data/ Consorsium has successfully synthesized seven chromosomes. Check the following links to learn about details related to each finished chromosomes: • synII synIII synV synV I synIXR synX synXI I In (Weiming Zhang et al., 2017) process building the whole synthetic chromosome XII. Having not yet obtained the synthetic genome from the authors, we have limited here our study to the concatenation of all wild type PCRTags on the one hand and synthetic ones on the other hand. For example: Forward wild type PCRTag : TGCTTGAACTGCAAATACAGGCCCACTC Forward synthetic PCRTag : AGCTTGGACAGCGAAAACTGGACCTGAT They published particularly all the wild type and synthetic PCR Tags. The full PCR Tags are available online: http://syntheticyeast.org/wp- content/uploads/2016/10/synXII_PCRtag.txt Details: PCRTags « PCRTags are alterations incorporated into most open reading frames (ORFs) (on average one per ORF, as some ORFs are too small and others contain multiple PCRTags). These are made by recoding a ~20bp segments of the coding region of an ORF to a different DNA sequence encoding the same amino acid sequence. PCR primer pairs can then be designed that will selectively amplify only the synthetic or wild type sequences. In this way, transformants that have incorporated a synthetic segment can be quickly scanned to ascertain that a complete substitution of the segment has occurred. PCRTags can also be used to monitor for the deletion of non-essential segments post- SCRaMbLE induction. » (from http://syntheticyeast.org/designs/alterations/pcrtags/) . We analysed 681 PCRTags of each 28 bp from wild YEAST XII and artificial SYN XII chromosomes. Then only resonances < 28 bp are to be considered in the following analysis. We run 3 analysis : Fibonacci sequence= 1 2 3 5 8 13 21 34 55 89 Lucas sequence= 1 3 4 7 11 18 29 47 76 FibLuc sequence= 5 7 12 19 31 50 81 131 Table 5: Comparing real and synthetic YEAST chromosome XII PCRTags with Fibonacci, Lucas and FibLuc resonances YEAST XII real genome (681 wild type PCRTags) Synthetic genome SYNXII (681 synthetic PCRTags) Fibonacci Lucas FibLuc Fibonacci Lucas FibLuc 3 6906 7073 0.976389 0853 3 7073 6906 1.024181 871 5 5726 5649 1.0136307 31 3 7133 7436 0.959252 2862 3 7436 7133 1.042478 62 5 6195 5982 1.0356068 2 5 5649 5726 0.986552 5672 4 4760 4886 0.974212 0344 7 3094 3237 0.9558232 932 5 5982 6195 0.965617 4334 4 4611 4948 0.931891 6734 7 3024 3330 0.9081081 081 8 4012 4124 0.972841 9011 7 4894 5032 0.972575 5167 12 3518 3552 0.9904279 279 8 4142 4396 0.942220 2002 7 5272 5456 0.966275 6598 12 3636 3918 0.9280245 023 13 2942 3009 0.977733 4663 11 2993 3058 0.978744 2773 19 1769 1924 0.9194386 694 13 2877 3272 0.879278 7286 11 2950 3383 0.872007 0943 19 1678 2038 0.8233562 316 © 2022 Global Journals 1 Year 2022 42 Global Journal of Science Frontier Research Volume XXII Issue ersion I VII ( G ) Epigenetics Theoretical Limits of Synthetic Genomes: The Cases of Artificials Caulobacter ( C. eth-2.0), Mycoplasma Mycoides (JCVI-Syn 1.0, JCVI-Syn 3.0 and JCVI_3A), E-coli and YEAST chr XII